Bas.J.Vet.Res.Vol.14,No.1.2015 SIS Impact Factors:0.792 ,ISI Impact Factor:3.259
EVALUATION OF THE ISOLATION AND DETECTION METHODS FOR SALMONELLA SPP. FROM EGG SHELL CONTAMINATION USING MULTIPLEX PCR.
Israa Adnan Ibraheam Al-Baghdady*, Ashwak Bassim Jassim** Zainab Khudher Ahmed***
*College of Science for women,University of Babil,Babil.Iraq **Genetic engineering and biotechnology for postgraduate studies ,University of Baghdad,Baghdad,Iraq
***College of Nursing,University of Babil.Babil, Iraq
(Received 21 October 2014 ,Accepted 8December2014) Keywords:- Egg shell, invAgene,Multiplex PCR
ABSTRACT
A total of seventy four egg samples were collected from different markets sources, to investigated for Salmonellaspp. the bacteria was isolated and identified using culturing on selective media, in addition to, biochemical and serotyping by monovalent antisera. Multiplex Polymerase Chain Reaction(PCR) detection of theinvA; and DH genes was used for conformation of the identification of the Salmonella spp.. Twenty eight samples from seventy four eggs provide positive results with PCR as Salmonella spp. depending on InvA gene which is the target for the identification at the genus level.
INTRODUCTION
Salmonella spp.considered among the leading causes of community acquired bacterial gastroenteritis worldwide and the second leading cause of bacterial foodborne illness(1).Salmonellosis are associated with the consumption of contaminated products such as poultry, meat, eggs, milk, seafood (2 ). Transmission is usually derived from fecal contamination on the egg shell,it also includes contamination through environmental vectors, such as farmers, pets and rodents.
Therefore, development of rapid and sensitive methodsfor detection of Salmonella directly from different samples may have a significant impacton the disease burden caused by this pathogen. Toolsdeveloped for such purposes could help both in preventing thespread of outbreaks and in diagnosis (3). Traditional methodsfor Salmonella identification are based on cultures using selective media and characterization of suspected colonies by biochemical and serological tests,these methods are generally time-consuming, therefore, a rapid method is necessary for the identification of Salmonella (4).
282
Bas.J.Vet.Res.Vol.14,No.1.2015 SIS Impact Factors:0.792 ,ISI Impact Factor:3.259
Molecular technique is alternative methods for Salmonella detection and typing,Polymerase Chain Reaction has become a potentially powerful tools in microbiological diagnostics due to its simplicity, rapidity, reproducibility, and accuracy.
The aim of this study was to investigate the contamination of table eggs with Salmonella speciesby specific multiplex PCR assay.
MATERIALS AND METHODS
Egg samples
Seventy four egg samples were collected from different markets sources,to investigated for Salmonellausing sterile cotton swabs to remove over entire surface area of the eggshell , two swabs were used for each sample.
Bacteriological Examination and identification:-
1-First swab was added to peptone broth, incubated for 24 h at 37°C.
2- Enriched in tetrathionate broth for 24 h at 37°C, streaking on selective media XLD and
SS agarfor 24h at 37°Cto isolate the suspected colonies of Salmonella.
3-Suspected colonies were selected and further biochemical tests with API 20E and Mini
API were done.
4- The isolates were confirmed as Salmonella by biochemical tests, send to reference laboratory /Central health public laboratory (CHPL) for serological conformation.
Molecular Identification of Salmonella spp.:- 1- DNA EXTRACTION:-
Total genomic DNA was isolated directly from 2ned swab which input in 200 ml distilled water in eppendroff tube,extraction carried out by using genomic DNA kit (Gene aid) according to(5).
2- PCR:-
PCR used for detection of theinvA;and DH genes for conformation the identification of the Salmonellaspp., according to(5).These primers synthesized by Cinna gen company (Table 1).
283
Bas.J.Vet.Res.Vol.14,No.1.2015 SIS Impact Factors:0.792 ,ISI Impact Factor:3.259
Table (1) : The sequence and concentration of forward and reverse primers oftheinvA; and DH genes.
Primer type
Primer size
Product size
(InvA gene) InvA F InvA R
CGAGCAGCCGCTTAGTATTGAG CCATCAAATTAGCGGAGGCTTC
881bp
(Flic-d gene) Dh F
Dh R
GCTTAATGTCCAAGATGCCTAC GAGCAACGCCAGTACCATCTG
587bp
PCR reaction was conducted in 100 ?l of reaction mixture containing 50 ?l of green master mix,5 ?l of each primer,10 ?l DNA template and 30 ?l of deionized water (Table 2).
Table (2): The mixture of conventional PCR working solution for detection of theinvA; and DH genes in Salmonella spp.
Working solution
Water
Forward primer Reverse primer DNA
Master mix
30 ?l 5 ?l 5 ?l 10 ?l 50 ?l
Final volume 100 ?l
Amplification was conducted using a master cycler eppendroff programmed with 30 cycler for Initial denaturation 95°C for 2 min. ,Denaturation for 94°C 30 sec., Anneling64°C 30 sec.,Extention72°C 30 sec. and final Extention 72 °C 5min. (Table 3).
284
Bas.J.Vet.Res.Vol.14,No.1.2015 SIS Impact Factors:0.792 ,ISI Impact Factor:3.259
Table (3): PCR program forfragmentinvA; and DH genes amplification by the conventional methods.
Thermocycler conditions
Temperature (°C )
Time ( min )
Initial denaturation Denturation Primmer annealing Primmer extension Final extend
95oC 94oC 64oC 72oC 72oC
2min. 25sec. 30sec. 30 min.
5 min.
Cycles number : 30 cycle
Gel Electrophoresis:-PCR products and the ladder marker were resolved by electrophoresis on 2% w/v agarose gels.
RESULTS AND DISCUSSION Examination of egg samples:-
A total of seventy four egg samples were tested by conventional culture method for detection of Salmonella spp.,thirty one samples were positive using culturing method table
(2).Depend on morphology, round pale colony with black center on XLD, SS agar..The outcome of biochemical tests clarified thatall isolates fermented glucose not lactose appeared as red surface and yellow bottom of KIA slant with gas and H2O formation for their further conformation API20E were used also in diagnosis according to (6) and (7).
Table (2): Results of Salmonella spp.detected by using culture methods and PCR method from different egg samples.
1- Egg analysis:-
No. of total samples
No. of positive samples
No. of negative samples
74
31(41.8%)
43 (58%)
28 samples were PCR Positive(37.8%)
31 samples were culture positive (41.8%)
285
Bas.J.Vet.Res.Vol.14,No.1.2015 SIS Impact Factors:0.792 ,ISI Impact Factor:3.259
Molecular level and PCR technique :-
All samples of egg were detected for contamination by Salmonella with PCR ,twenty eight samples from seventy four eggs provide positive results with PCR as salmonella spp. depending on InvA gene which is the target for the diagnosis at the genus level, which is located on the pathogenicity island 1 of Salmonella spp.it is essential for invasion of epithelial cells (8).All isolates formed PCR products of the expected size ,Dh primer for the detection of Flic- d gene give positive results in all Salmonella isolateswhich is present in over 100 Salmonellaserovar fig.(1)which, encode for the synthesis ofH (flagellar) antigens one of the three antigens responsible for the basis of classification for Salmonella by Kauffman–White scheme (9).
Fig.(1): agarose gel electrophoresis of PCR product. PCR was carried out with DNA obtained from Salmonella spp.(line1 and line 13 are marker 50bp), line 2 was positive control, line 3 was negative control, line 4,5,7-10, 12 were positive for Salmonella spp. .
Multiplex PCR can be used as quality control method for detect egg contamination from different sources.Salmonella in eggs constitute a public health warning, can colonize the ovaries of hens and contaminate the internal contents of eggs(10) .
286
Bas.J.Vet.Res.Vol.14,No.1.2015 SIS Impact Factors:0.792 ,ISI Impact Factor:3.259
استخدام السلسلة المتبلمره المتعددةالثنائية لتقييم وتشخيص التلوث بجرثومة السالمونيلافي قشرة??
البيض
إسراء عدنان ابراھيم * ، أشواق باسم جاسم **، زينب خضر احمد ***
*كلية التربيھ للبنات ،جامعة بابل ،بابل ،العراق.
**معھد الھندسھ الوراثيھ والتقانات الاحيائيھ وجامعة بغداد ،بغداد ،العراق. كلية التمريض، جامعة بابل ،بابل ،العراق.
الخلاصة
جمعت أربعھ وسبعين عينھ من البيض من اسواق مختلفة لغرض فحص السالمونيلا وتم عزل البكتريا وشخصت باستخدام الزرع على وسط زرعي انتقائي بالإضافة الى الفحوصات الكيموحيويھ والسيرولوجيھ. أستخدمت تقنية السلسلة المتبلمره المتعددة الثنائية بالاعتماد على تشخيص كل من جينات invA; DH لغرض تأكيد تشخيص بكتريا السالمونيلا.أعطت ثمانية وعشرون عينھ من مجموع اربعھ وسبعين نتائج موجبھ اعتمادا على تقنية البلمره
المتسلسلة على أنھا بكتريا السالمونيلا اعتمادا على جين InvA الذي يعد مھما لتشخيصھا على مستوى النوع.
REFERENCES
1- Todd, E.C. (1997). Epidemiology offoodborne diseases: a worldwidereview. World Health Stat Q .50: 30–50.
2- Magda, M.; Madeha, N.; Safaa, Y. and Nagwa, M. (2010). Mineral content and microbiological examination of some white cheese in Jeddah, Saudi Arabia during summer 2008. Food and Chem. Toxicol., 48:3031-3034.
3- Van der Zee, H. &Huisin’t Veld, J. H. J. (2000). Methods for the rapid detection of Salmonella. In Salmonella in Domestic Animals, pp. 373–391. Edited by C. Wray & A. Wray. Wallingford, UK: CABI Publishing.
4-Darif,E.; Francine J.; Elizabeth,D; John Threlfall,E.; Frederick, J. ;Andrew J. Fox, and Mathew Upton.(2010).Development of a Multiplex Primer Extension Assay for Rapid Detection of Salmonella Isolates of Diverse Serotypes.J. Clinical. Microbiol..48(4). .1060–1055
5- Kumar, S; Balakrishna, K. and H.V. Batra.(2005). Detection of SalmonellaentericaserovarTyphi (S. Typhi) by selective amplification of invA, viaB, fliC- d and prt genes by polymerase chain reaction in multiplex format . Letters in Applied Microbiology, (42 ):149–154.
6- Jawetz,E.; Melnick,J.I.; and Adelberg,E.A.(2001). Medicalmicrobiology.(22nd ed.). Appleton and Lange USA.
7- Amini , K.; Salehi1, T. Z. ; Nikbakht , G.; Ranjbar , R.; Shahrnaz, J. A.andganjooei, B.
287
Bas.J.Vet.Res.Vol.14,No.1.2015 SIS Impact Factors:0.792 ,ISI Impact Factor:3.259
A. ( 2010).Molecular detection of invAand spvvirulence genes in Salmonella enteritidisisolated from human and animals in Iran. African J. of Microbiology Research .4(21), 2202-2210.
8- Collazo C.; Gal?n J. (1997) . The invasion-associated type III system of Salmonella typhimuriumdirects the translocation of Sip proteins into the host cell. Molecular Microbiology, 24:747–756.
9- Chaudhry, R., Laxmi, B.V., Nisar, N., Ray, K. and Kumar, D. (1997). Standardization of polymerase chain reaction for the detection of Salmonella typhi in typhoid fever. J Clinical Pathol. 50, 437–439.
10- Cook, L, Levine, P, and Oatman, N. (2004).Salmonella spp. and Listeria monocytogenes in raw liquid egg products in federally inspected processing establishments. International Association for Food Protection General Meeting. 2004. Phoenix.
.
288