International Journal of Science and Research (IJSR)
ISSN (Online): 2319-7064
Impact Factor (2012): 3.358
Volume 3 Issue 8, August 2014
www.ijsr.net
Licensed Under Creative Commons Attribution CC BY
Using of astA and uidA Genes Characterization in
Detection of Escherichia coli Prevalence from
Human Gallstone
Sama J. AL-zuwainy, Abdalnabi J. Abid*
Biology Department, College of Science for Women, Babylon University, Iraq
Abstract: A total of 150 Gallstones samples were collected from patients undergoing cholecystectomy at the general teaching Hilla
Hospital from November 2011 to June 2012. All samples were surveyed and examined for the presences of the Escherichia coliand
differentiate it from other bacterial species. The Bacterial isolates were identified by using morphological and biochemical diagnostic
investigations methods; Samples were cultured on Eosin Methylene Blue Agar (EMB), incubated at 37C? for 24 hrs, and then cultured
on MacConkey Agar (MAC).50 bacterial isolates were identified as Escherichia coli. By using traditional biochemical tests. The
Bacterial isolates were further identified by using Single Polymerase Chain Reaction (SPCR) technique for the presence or absence of 2
genes (astA, uidA) that encode for main virulence factors to diagnose E. coli isolated from Gallstones by using specific primers for these
genes. Appearance of ustA and uidA in E.coli that isolated from gallstone confirmed the importance of these genes in gallstone
formation through their ability to encoded B-glucuronidase.
Keywords: gallstone, E.coli, uidA, astA, PCR.
1. Introduction
E-coliis one of the most important members of the
Enterobacteriaceae. Strains predominate among the
aerobic commensal bacteria in the healthy human intestine
(Colleeet.al., 1996).Bacterial B-glucuronidase produced
by E-coli is an important enzyme which deconjugates
bilirubin diglucuronide, resulting in the release of free
bilirubin and glucuronic acid , the former precipitates with
calcium ion to form calcium bilirubinate, which is the
major component of brown pigment stones. It is assumed
that one of the factors playing a role in the pathogenesis of
gallstones is E-coli (Lee et.al., 1999).In the pathogenesis
of bacterial infections, great significance is assigned to the
adherence properties of bacteria, the permanent
attachment of the microorganism to the cells of the host
which causes lasting damage (Spitz et. al.,
1995).Numerous investigators have proposed a role for
bacteria in biliary lithogenesis. We hypothesized that
bacterial DNA is present in gallstones, and that categorical
differences exist between gallstone type and the frequency
of bacterial sequences(Lee ,et.al.,1999 ).We utilized the
polymerase chain reaction (PCR) to establish the presence
of bacterial DNA, in gallstones, bile juice, and gallbladder
mucosa from patients with gallstones(Lee ,et.al.,2010).
Strains of entero-aggregative E. coli (EAEC), the most
recently recognizedcategory of diarrhea genicE. coli,
adhere to HeLa cells in vitro in an aggregative adherence
pattern and are associated with watery diarrhea in young
children in thedeveloping world. The pathogenesis of
EAEC infection is not fullyunderstood; however, a
characteristic histopathological lesion and several
candidatevirulence factors have been described (Nataro
and Kaper, 1998; Scaletsky, et.al., 1984). One of them is a
38-amino-acid protein called entero-aggregative E. coli
heat-stable enterotoxin 1 (EAST1), encoded by the
astAgene, located on plasmids, on the chromosome, or on
both of them (Savarinoet.al., 1993; Yamamoto et.al.,
1997). The role of EAST1 in induction of diarrhea has not
been clearly determined, however, the production of this
toxin with several human ETEC strains has been
demonstrated (Yamamoto et.al., 1997).The EAST1 gene
was also detected in human ETEC isolated from patients
with diarrhea and was mainly found among strains
possessing major adherence factors such as colonization
factor antigens (CFA) I and II (Yamamoto and
Echeverria,1996).
Bacterial DNA sequences are usually present in mixed
cholesterol (to 95% cholesterol content), brown pigment,
and common bile duct, but rarely in pure cholesterol
gallstones. The presence of bacterial B-glucuronidase is
also suggested. The role of bacteria and their products in
the formation of mixed cholesterol gallstones, which
comprise the majority of cholesterol gallstones (Lee,
et.al., 1999).
The uidA gene, which encodes for B-glucuronidase, has
been used for detecting E. coli in previous studies (Bejet
al. 1991a; Martins et al. 1993; Tsai et al. 1993; McDaniels
et al. 1996; Iqbal et al. 1997; Lasalde et al. 2003).
Although, the uidA and uidR genes are present in E. coli
and Shigella spp. the activity of the enzyme is limited to
E. coli. However, some E. coli fecal isolates have been
shown to be negative for this activity, although the genes
for the enzyme are present in these isolates (Martins et al.
1993; McDanielset al. 1996; Monday et al. 2001). Studies
show that many MUG negative E. coli strains, including
the pathogenic serotype O157:H7, were detected after
PCR amplification of the uidA gene (Bejet al. 1991a,b;
Martins et al. 1993; Iqbal et al. 1997; Monday et al. 2001;
Rompreet al. 2002).
2. Materials and Methods
During the period from November 2011 to June 2012, 150
patients with symptomatic gallstone underwent
electivecholecystectomy done in surgical unit at Hilla
teaching Hospital. During surgery, gallstones were
Paper ID: 020141233 935
International Journal of Science and Research (IJSR)
ISSN (Online): 2319-7064
Impact Factor (2012): 3.358
Volume 3 Issue 8, August 2014
www.ijsr.net
Licensed Under Creative Commons Attribution CC BY
collected from different age patients (18-70 years) and
different sexes (92 females and 16 males). The stone was
washed with normal sterile saline to remove surface
contaminants and each core of gallstone was scoped for
bacterial culture. A single colony was taken from each
primary positive culture on Eosin Methylene Blue
Agar(EMB) and it was identified depending on its
morphology (shape, size, borders, and texture ) and then it
was examined under microscope after staining it with
Gram stain .After staining , the biochemical tests were
done on each isolate to complete the final
identification(Collee et. al.1996).eight specific
biochemical tests (Indol Test ,Urease Test,Citrate
Utilization Test ,MethylRed Test, Oxidase test , Catalase
test , Motility Test , Haemolysis test ). were done to
differentiate E. coliisolates from other
bacteria(Holtet.al.,1994).
Detection of selected virulence determinants by PCR
The genes selected for Single PCR( uidA, astA) were
amplified by PCR with the optimized primerpairs listed
in Table 1. The PCR reaction of astAgene was performed
by using a 25?l reaction mixture consisting of 12.5ul
green master mixulastA2.5 ,-F, 2.5ul astA-Rul3 , DNA
template ,4.5ul nuclease-free water.AndThe PCR reaction
ofuidA,gene was performed by using a 25?l reaction
mixture consisting of 12.5ul green master mix ,2.5ul
uidA-F,2.5ul uidA-R,3ul DNA template , 4.5ul nucleasefree
water. Thermocycling conditions were as follows:
94°C for 55 min, 30 cycles of 94°C for 30 sec, 63°C for
30 sec and 72°C for 1.5 min, with a final extension at
72°C for 5 min. PCR-amplified fragments (10 ?l) were
separated on 2.0% (w/v) agarose gels and visualized under
UV light after staining with ethidium bromide (Muller
et.al., 2007).
Table 1: Primer pairs used for detection of marker genes indicative of a particular pathotype
Primers Sequence Product Size( Bp) Denaturation Annealing Extension
uidA F ATGCCAGTCCAGCGTTTTTGC
102 bp
94OC for 5 min. 1cycle
94OC for 30 sec.
63OC for 30 sec.
72OC for 1.5 min.
30 cycle
72OC for 5 min.1cycle.
uidA R AAAGTGTGGGTCAATAATCAGGAAGTG
astA F TGCCATCAACACAGTATAT
CCG
1487 bp
94OC for 5 min. 1cycle
94OC for 30 sec.
63OC for 30 sec.
72OC for 1.5 min.
30 cycle
72OC for 5 min.1cycle.
astA R ACGGCTTTGTAGTCCTTCCAT
Table 2: Master mix used in PCR
Master mix 2x Source
Go taq DNA polymerase is supplied in 2x Green tag reaction buffer pH 8.5, 400 ?m dATP, 400 ?m d GTP, 400 ?m dCTP,
400 ?m dTTP and 3 ?m MgCl2
Promega
(USA)
3. Results and Discussion
A total of 150 Gallstones samples were collected from
patients undergoing cholecystectomy. .50 bacterial
isolates were identified as Escherichia coli using
traditional biochemical tests .These Bacterial isolates were
undergoing a further identification through detection of
two specific diagnostic genes by using Single Polymerase
Chain Reaction (SPCR) technique.
Detection of astAgene
PCR identification of the astAgene revealed that among
50 E. coli isolates analyzed, 32 (64 %) isolates were
positive as determined by the presence of the 102 bp
amplified product whereas the other 18 isolates (36%)
show negative results for this gene (table 3 ,figure1).
Table 3: Identification of uidA and astA genes for E.coli bacteria isolated from gallstones
Gene No. of strains Positive Negative No. % No. %
astA 50 32 64% 18 36%
uidA 50 43 86% 7 14%
In the present study, the prevalence of the astAgene in E.
coli isolated from patients with gallstone was examined.
Several previous studies showed that most E. coli strains
possessing genesfor at least one enterotoxin type
(classified as ETEC) harbored the additional marker
encoding the production of EAST1 toxin. Moreover, a
close association of the astAgene with the presence of
porcine fimbria colonization factor F4 was demonstrated
(Nagy and Fekete, 1999; Osek, 1999), Therefore, the
association of the EAST1 gene with F4-
positiveenterotoxigenic strains recovered from piglets
with enteric disorders suggests that the entero-aggregative
Paper ID: 020141233 936
International Journal of Science and Research (IJSR)
ISSN (Online): 2319-7064
Impact Factor (2012): 3.358
Volume 3 Issue 8, August 2014
www.ijsr.net
Licensed Under Creative Commons Attribution CC BY
E. coli heat-stable enterotoxin 1 may be a virulence
marker ofisolates pathogenic for these animals (Osek,
2003).
The EAST1 gene was also detected in human ETEC
isolated from patientswith diarrhea and was mainly found
among strains possessing major adherence factors such as
colonization factor antigens (CFA) I and II (Yamamoto
and Echeverria, 1996). These authors have
alsodemonstrated that the genes for EAST1 and CFA are
located on the same plasmidwhereas in porcine ETEC
strains the astA and F4 virulence factors are carried on
separate plasmids (Yamamoto and Nakazawa, 1997).
Moreover, the EAST1 gene sequence of porcine F4-
positiveETEC isolates was different from that of human
CFA+ ETEC strains (Yamamoto et.al., 1997). On the
otherhand, the pig origin EAST1 gene sequence is
identical to that of strain O42 pathogenicfor human
volunteers (Yamamoto and Echeverria, 1996).
Recently, Frydendahl, 2002 analyzed 563 E. coliisolates
from 503 pigs with post weaning diarrhea and showed a
high frequency (65.8%) of strains possessing the
astAgene. The author also observed a close correlation
between the presence of theEAST1 toxin marker and F4
fimbrial as well as LTI and STII enterotoxin genes. (Choi
et al., 2001) analyzed 720 E. coli strains isolated from
piglets with entericcolibacillus s for the presence of the
astAgene and again a close association of theEAST1 gene
with the F4 fimbrial marker was found.
In conclusion, the results of the present work indicate that
the astA gene is widely distributed among E. coli strains
isolated from patients with gallstone. Therefore, EAST1
toxinmay represent an additional determinant playing a
role in the pathogenesis of E. coli. Moreover, the presence
of the astAgene makes the porcine E. coli strains similar to
human EAST1-positive isolates that are potentiallyable to
induce diarrhea (Osek, 2003).
Figure 1: Agarose gel electrophoresis presenting the PCR
results obtained with astA primers. Lane M, molecular
mass marker (100 – 1500 bp range); lanes 1, 5, 6,7,8,9
astA-positiveE. coli; lanes 2,3,4,10,11,12 astA-negative E.
coli
Detection of uidAgene
PCR identification of the uidAgene revealed that among
50 E. coli isolatesanalyzed, 43 (86 %) isolates were
positive as determined by the presence ofthe 1487bp
amplified product (figure2). The remaining 7 (14%)
strains testedwith the PCR method for the uidAmarker did
not generate a PCR amplicon of 1487bp or any other size (
table 3).
beta-glucuronidase (GUD) is an inducible enzyme that is
encoded by the uidAgene in E. coli(Jefferson,et.al.1986).
About 94% of E. coli strains andsome Shigellaspp. (44%)
and Salmonella spp. (29%) appearto be the only members
of the family Enterobacteriaceaethat produce GUD,
except for the pathogenicenter hemorrhagicE. coli of
serotype 0157:H7, which is4-methylumbelliferyl-beta -Dglucuronide(
MUG) negative (Feng et.al.1991).
Bacterial beta-glucuronidase causes deconjugation of
bilirubin diglucuronide resulting in the precipitation of
calcium bilirubinate, which contributes to biliary sludge
and stone formation. This processes attributed to enzyme
activity produced by the aerobic Enterobacteriaceae such
as E. coli and Klebsiella sp. E. coli with its higher enzyme
activity is more important in the deconjugation of
bilirubin diglucuronide (Swidsinski and Lee, 2001).
Polymerase chain reaction (PCR) was used to amplify
uidA (encoding Escherichia coli [E. coli] betaglucuronidase)
genes in different types of gallstones. PCR
products were sequenced.Bacterial DNA sequences are
usually present in mixed cholesterol (to 95% cholesterol
content), brown pigment, and common bile duct, but
rarely in pure cholesterol gallstones. The presence of
bacterial beta-glucuronidase is also suggested. The role of
bacteria and their products in the formation of mixed
cholesterol gallstones, which comprise the majority of
cholesterol gallstones, warrants further study.
Numerous investigators have proposed a role for bacteria
in biliary lithogenesis. We hypothesized that bacterial
DNA is present in gallstones, and that categorical
differences exist between gallstone type and the frequency
of bacterial sequences.
Bacterial 16S rRNA and uidA DNA sequences in E. coli
were detected in all brown pigment, common bile duct,
and mixed cholesterol gallstones (n = 14). In contrast,
only one (14%) of seven pure cholesterol gallstones
yielded a PCR product. Most (88%) mixed cholesterol
gallstones yielded PCR amplification products from their
central, as well as their outer, portions. Sequenced
products possessed 88–98% identity to 16S rRNA genes
of E. coli and Pseudomonasspecies (Lee et.al., 1999).
Bacterial infection is accepted as a precipitating factor in
cholesterol gallstone formation, and recent studies have
revealed the presence of E. coli species in the
hepatobiliary system. We utilized the polymerase chain
reaction (PCR) to establish the presence of bacterial DNA,
including from E. coli species, in gallstones, bile juice,
Paper ID: 020141233 937
International Journal of Science and Research (IJSR)
ISSN (Online): 2319-7064
Impact Factor (2012): 3.358
Volume 3 Issue 8, August 2014
www.ijsr.net
Licensed Under Creative Commons Attribution CC BY
and gallbladder mucosa from patients with gallstones
(Lee, et.al., 2010).
Figure 2: Agarose gel electrophoresis presenting the PCR
results obtained with uidA primers. Lane M, molecular
mass marker (100 – 1500 bp range); lanes 12 ,4
uidA -positive E. coli; lanes 1,2,3,5,6,7,8,9,10,11 uidA -
negative E. coli .
References
[1] Bej, A. K.; Di Cesare, J. L.; Haff, L. and Atlas, R. M.
(1991a). Detection of Escherichia coli and Shigella
spp. in water by using the polymerase chain reaction
and genes probes for uid. Appl . Environ. Microbiol.,
57(4): 1013–1017.
[2] Bej, A. K.; Mc Carty, S. C. and Atlas, R. M.( 1991b).
Detection of coliform bacteria and Escherichia coli by
multiplex Polymerase Chain Reaction: comparison
with defined substrate and plating methods for water
quality monitoring. Appl. Environ. Microbiol. 57(8):
2429– 2432.
[3] Choi, C.; Kwon, D. and Chae, C. (2001). Prevalence
of the entero-aggregative Escherichia coli heat-stable
enterotoxin 1 gene and its relationship with fimbria
and toxin genes in E. coli isolated from diarrheic
piglets. J. Vet. Diagn.Invest., 13: 26-29.
[4] Collee, J.; Garald, G.; Fraser, F.; Andrew, G.;
Marmion, M.; Barrie,P.; Simmon, S. and Anthong, N.
(1996). Practical medical micro-biology.14th ed.
Churchill Livingstone.Newyork., P: 131-150.
[5] Feng, P.; Lum, R. and Chang, G.W.(1991).
Identification of uidA Gene Sequences in B-D-
[6] Glucuronidase-Negative Escherichia coli.Appl.
Environ. Microbial, 57(1): 320-323.
[7] Frydendahl K.( 2002). Prevalence of serogroups and
virulence genes in Escherichia coli associated with
postweaningdiarrhoea and edema disease in pigs and
a comparison of diagnostic approaches. Microbiol.,
85: 169-182.
[8] Holt, J.G.; Kreig, N.R.; Sneath, P.H.A.; Staley, J.T.
and Williams, S.T. (1994). In Bergey s Manual of
Determinative Bacteriology, 9th .ed. The Williams
and Wilkins Co., Baltimore.
[9] Iqbal, S.; Robinson, J.; Deere, D.; Saunders, J. R.;
Edwards, C.and Porter, J. (1997).Efficiency of the
polymerase chain reaction amplification of the uid
gene for detection of Escherichia coli in contaminated
water.Lett. Appl. Microbiol., 24: 498–502.
[10] Jefferson, R. A.; Burgess, S. M. and Hirsh, D.( 1986).
F-glucuronidase from Escherichia coli as a genefusion
marker. Proc. Natl. Acad. Sci. USA 83:8447-
8451.
[11] Lasalde, C.; Huertas, A.; Rodr?´guez, R.; Toranzos,
G. A. (2003). Escherichia coli populations and uidA
gene variation in atropical rain forest soil. 103rd
American Society for Microbiology (ASM) General
Meeting. Washington, DC. pp: 18–22.
[12] Lee, D.K.; Tarr, P.I.; Haigh, W.G. and Lee, S.P.
(1999).Bacterial DNA in mixed cholesterol gallstone.
Am. J .Gastroenterol., 94 (12) : 3502-3506.
[13] Lee, J.W.; Lee, D.H.; Lee, J.I.; Jeong, S.; Kwon,
K.S.; Kim, H.G.; Shin, Y.W.; Kim, Y.S.; Choi, M.S.
and Song, S.Y.(2010). Identification of Helicobacter
pylori in Gallstone, Bile, and Other Hepatobiliary
Tissues of Patients with Cholecystitis .Nat. Inst.
Health, 4(1):60-67.
[14] Martins, M. T., Rivera, I. G., Clark, D. L., Stewart,
M. H., Wolfe,R.L. and Olson, B. H. (1993).
Distribution of uidA gene sequences in Escherichia
coli isolates in water sources and comparison with the
expression of b-glucuronidase activity in 4-
methylumbelliferyl- b-D-glucuronide media. Appl.
Environ. Microbiol., 59(7): 2271–2276.
[15]Mc Daniels, A. E.; Rice, E. W.; Reyes, A. L.;
Johnson, C. H.; Haugland, R. A. and Stelma, G. N.
(1996 ).Confirmational identification of Escherichia
coli, a comparison of genotypic and phenotypic
assays for glutamate decarboxylase and b-Dglucuronidase.
Appl. Environ. Microbiol.,
62(9):3350–3354.
[16]Monday,S. R.; Whittam, T. S. and Feng, P. C. H.(
2001). Genetic and evolutionary analysis of mutations
in the gusA gene that cause the absence of b-
Glucuronidase activity in Escherichia coli O157:H7.
J. Infect. Dis., 184: 918–921.
[17]Muller, D.; Greune, L.; Heusipp, G.; Karch, H.;
Fruth, A.; Tschape, H. and Schmidt
A.M.(2007).Identification of unconventional
intestinal pathogenic E.coli isolates expressing
intermediate virulence facter profiles by using novel
single-step multiplex PCR. Appl. and Env.Micro.,
73(10):3380-3390.
[18]Nagy, B.andFekete, P.Z. (1999). Enterotoxigenic
Escherichia coli (ETEC) in farm animals. Vet. Res.
30: 259-284.
[19]Nataro, J.P. and Kaper, J.B.(1998).
DiarrheagenicEscherichia coli.Clin.Microbiol. Rev.,
11: 142-201.
[20]Osek, J.(2003). Identification of the astA gene in
enterotoxigenic Escherichia coli responsible for
diarrhea in pigs. Bull. Vet. Inst. Pulawy., 47: 9-15.
[21]Osek, J.( 1999). Prevalence of virulence factors of
Escherichia coli strains isolated from diarrheic and
healthy piglets after weaning. Vet. Microbiol . 68:
209-217.
[22]Rompre, A.; Servais, P.; Baudart, J.; de-Roubin, M.
and Laurent, P. (2002) . Detection and enumeration of
coliforms in drinking water: current methods and
emerging approaches. J. Microbiol. Meth., 49: 31–54.
Paper ID: 020141233 938
International Journal of Science and Research (IJSR)
ISSN (Online): 2319-7064
Impact Factor (2012): 3.358
Volume 3 Issue 8, August 2014
www.ijsr.net
Licensed Under Creative Commons Attribution CC BY
[23] Scaletsky, I.C.A.; Silva, M.L.M. and Trabulsi, L.R.
(1984). Distinctive patterns of adherence of
enteropathogenicEscherichia coli to HeLa cells.
Infect. Immun.45: 534-536.
[24] Spitz, J.; Yuhan, R. and Koutsouris, A.
(1995).EnteropathogenicEschericha coli adherence to
intestinal epithelinal monolayers diminishes barrier
function. Am.J.Physiol., 268:374-9.
[25]Swidsinski, A. ; and Lee S.P. (2001) .The role of
bacteria in gallstone pathogenesis. Frontiers in
Bioscience. 6: 93-103.
[26] Tsai, Y.; Palmer, C. J. and Sangermano, L. R. (1993).
Detection of Escherichia coli in sewage sludge by
polymerase chain reaction. Appl. Environ. Microbiol.,
59(2): 353–357.
[27]Yamamoto,T. and Echeverria,P.(1996).Detection of
the enteroaggregative Escherichia coli heat-stable
enterotoxin 1 gene sequences in enterotoxigenicE.
coli strainspathogenic for humans. Infect. Immun.,
64: 1441-1445.
[28]Yamamoto, T.; Wakisaka, N.; Sato, F. and Kato, A.(
1997).Comparison of the nucleotide sequence of
enteroaggregativeEscherichia coli heat- stable
enterotoxin 1 genes among diarrhea-associated
Escherichia coli. FEMS Microbiol.Lett., 147:89-95.
[29]Yamamoto, T. and Nakazawa, M.( 1997). Detection
and sequences of the enteroaggregativeEscherichia
coli heat-stable enterotoxin 1 gene in
enterotoxigenicE. coli strains isolated from piglets
and calves with diarrhea. J. Clin. Microbiol., 35:
223-227
Paper ID: 020141233 939